ID: 1025206520_1025206529

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1025206520 1025206529
Species Human (GRCh38) Human (GRCh38)
Location 7:56996277-56996299 7:56996307-56996329
Sequence CCTCCCAGGGGCTGGGCACGGCT GGCAGGAGCCACAGTGGGAAGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 7, 3: 53, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!