ID: 1025208410_1025208421

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1025208410 1025208421
Species Human (GRCh38) Human (GRCh38)
Location 7:57007077-57007099 7:57007125-57007147
Sequence CCCCCATCTCTACAAAAATGAAA CCATCAACTCAGGCGGCCGAGGG
Strand - +
Off-target summary {0: 3, 1: 141, 2: 883, 3: 2596, 4: 7273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!