ID: 1025231009_1025231021

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1025231009 1025231021
Species Human (GRCh38) Human (GRCh38)
Location 7:57203343-57203365 7:57203384-57203406
Sequence CCCTCCGCCGGGCTTCCGTGCGC GCACGCACCTCTCGCAGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!