ID: 1025275778_1025275785

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1025275778 1025275785
Species Human (GRCh38) Human (GRCh38)
Location 7:57580467-57580489 7:57580489-57580511
Sequence CCTGGCTATCTGGGGCTATACTG GCCCGTGGTGGCAGGGGTGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 33, 3: 332, 4: 1114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!