ID: 1025280367_1025280372

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1025280367 1025280372
Species Human (GRCh38) Human (GRCh38)
Location 7:57622585-57622607 7:57622615-57622637
Sequence CCTGTGCCCAGGTGTGCAGCCTG TAGGCTGTGCCATAGAGCCTAGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 8, 3: 30, 4: 395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!