ID: 1025281643_1025281653

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1025281643 1025281653
Species Human (GRCh38) Human (GRCh38)
Location 7:57629869-57629891 7:57629915-57629937
Sequence CCTCCGGCCCCAAGGAGGCATCA GACCGCCTGAACCTCCGCCAGGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 0, 3: 14, 4: 164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!