ID: 1025284346_1025284351

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1025284346 1025284351
Species Human (GRCh38) Human (GRCh38)
Location 7:57650118-57650140 7:57650144-57650166
Sequence CCAGGGGAGGCAGAGCAAGAGGG ACAGAGCAGAAGAAGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 72, 4: 817} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!