ID: 1025304358_1025304364

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1025304358 1025304364
Species Human (GRCh38) Human (GRCh38)
Location 7:57842875-57842897 7:57842909-57842931
Sequence CCTACCGTACACCTAGGCTCTAT CTGCTCTCAGGCTGCACACCTGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 2, 3: 27, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!