ID: 1025608188_1025608193

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1025608188 1025608193
Species Human (GRCh38) Human (GRCh38)
Location 7:63054365-63054387 7:63054399-63054421
Sequence CCCCACGAAGAGGATCTTGGCCT GTCCGCCGCGGCGCAGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 80} {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!