ID: 1025659834_1025659849

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1025659834 1025659849
Species Human (GRCh38) Human (GRCh38)
Location 7:63551042-63551064 7:63551094-63551116
Sequence CCCAGCCCGTCCACTGCATGCCT AGCTCCCTCTGAGAAGGGGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 25, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!