ID: 1025703528_1025703529

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1025703528 1025703529
Species Human (GRCh38) Human (GRCh38)
Location 7:63842174-63842196 7:63842226-63842248
Sequence CCAAAATATATGTGTGTATACAC CACACATATATGTAAAAGATTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 17, 3: 106, 4: 684} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!