ID: 1025724940_1025724946

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1025724940 1025724946
Species Human (GRCh38) Human (GRCh38)
Location 7:64047775-64047797 7:64047810-64047832
Sequence CCTTTCTGCAGACACATTGGTGC GTGCTGGTATTGAGGGAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 2, 3: 21, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!