ID: 1025730546_1025730559

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1025730546 1025730559
Species Human (GRCh38) Human (GRCh38)
Location 7:64103169-64103191 7:64103221-64103243
Sequence CCCACGGTGCTGCTGTCACTCCA AACAGGCAGCTTCGGGGGGCCGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 11, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!