ID: 1025738489_1025738501

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1025738489 1025738501
Species Human (GRCh38) Human (GRCh38)
Location 7:64175295-64175317 7:64175343-64175365
Sequence CCCACCCCAGGCCGGCTCCATGC CAGGGTCCTCTGTTGTAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 21, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!