ID: 1025745745_1025745749

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1025745745 1025745749
Species Human (GRCh38) Human (GRCh38)
Location 7:64241314-64241336 7:64241327-64241349
Sequence CCCAATCCCAATTGTGGAGACAG GTGGAGACAGACCACGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169} {0: 1, 1: 1, 2: 0, 3: 7, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!