ID: 1025751117_1025751127

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1025751117 1025751127
Species Human (GRCh38) Human (GRCh38)
Location 7:64294697-64294719 7:64294737-64294759
Sequence CCAGGTATATGGCACAATACAAC CCAGAAAAGACACATCACTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!