ID: 1025775991_1025776000

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1025775991 1025776000
Species Human (GRCh38) Human (GRCh38)
Location 7:64561415-64561437 7:64561468-64561490
Sequence CCCATAAAGTTTCCAAAGGGAAA CTGTGCCTATGGAAGATAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 7, 3: 32, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!