ID: 1025812172_1025812179

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1025812172 1025812179
Species Human (GRCh38) Human (GRCh38)
Location 7:64882303-64882325 7:64882324-64882346
Sequence CCTCCTCCTCCAGGGGGAGCCGA GACCACGGAGACGCCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 295} {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!