ID: 1025879494_1025879505

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1025879494 1025879505
Species Human (GRCh38) Human (GRCh38)
Location 7:65521318-65521340 7:65521367-65521389
Sequence CCAAACACCGCATGTTCTCACTC ACATGGACACTGCAGGTGGGGGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 1, 3: 20, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!