ID: 1025912744_1025912751

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1025912744 1025912751
Species Human (GRCh38) Human (GRCh38)
Location 7:65841021-65841043 7:65841059-65841081
Sequence CCACGCTCATGCCTCACTGTGGC TTTCGCTTTTTGGCCACTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!