ID: 1025974561_1025974564

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1025974561 1025974564
Species Human (GRCh38) Human (GRCh38)
Location 7:66359423-66359445 7:66359444-66359466
Sequence CCTGGACACTTGAAGAACCTTAG AGGACCCATTTCTTCACATAAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 1, 3: 7, 4: 95} {0: 1, 1: 5, 2: 1, 3: 8, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!