ID: 1025974575_1025974580

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1025974575 1025974580
Species Human (GRCh38) Human (GRCh38)
Location 7:66359503-66359525 7:66359528-66359550
Sequence CCTTAGGACCCATTTCTTCACAC GGAATCATGGTGCTGACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 1, 3: 13, 4: 154} {0: 1, 1: 2, 2: 5, 3: 18, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!