ID: 1025982941_1025982949

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1025982941 1025982949
Species Human (GRCh38) Human (GRCh38)
Location 7:66422267-66422289 7:66422294-66422316
Sequence CCTTGGCCCATCTGCCATGAAAG CGTGTGGGGGACAGATACATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!