ID: 1025996069_1025996072

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1025996069 1025996072
Species Human (GRCh38) Human (GRCh38)
Location 7:66528276-66528298 7:66528297-66528319
Sequence CCTGCCTGCAAGGGGCTGAGACA CAACCCACGCTCGACCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 304} {0: 1, 1: 1, 2: 0, 3: 2, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!