ID: 1025996073_1025996080

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1025996073 1025996080
Species Human (GRCh38) Human (GRCh38)
Location 7:66528300-66528322 7:66528341-66528363
Sequence CCCACGCTCGACCCTGAGGGCTG TAGCTCTATACTGCCCAACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 89} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!