ID: 1026020003_1026020008

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1026020003 1026020008
Species Human (GRCh38) Human (GRCh38)
Location 7:66698920-66698942 7:66698941-66698963
Sequence CCCTTGGCTGGTCACAAGTAACT CTCCGGTGACTGCAGGGCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 31, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!