ID: 1026025543_1026025557

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1026025543 1026025557
Species Human (GRCh38) Human (GRCh38)
Location 7:66741097-66741119 7:66741132-66741154
Sequence CCTGGCCGCCTCCCTCTCCGGCG CCGGCTCCCACCTTCCGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 30, 4: 373} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!