ID: 1026047969_1026047976

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1026047969 1026047976
Species Human (GRCh38) Human (GRCh38)
Location 7:66921227-66921249 7:66921248-66921270
Sequence CCGGAAACCGCGGTTGCCGGAGC GCCCGAACTGAGGCGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30} {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!