ID: 1026063335_1026063336

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1026063335 1026063336
Species Human (GRCh38) Human (GRCh38)
Location 7:67046266-67046288 7:67046290-67046312
Sequence CCTTTGGTTCTGCTTGTGGTTGA TTTTTAGTTCTGATTGCCTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 166} {0: 2, 1: 0, 2: 0, 3: 21, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!