ID: 1026067662_1026067675

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1026067662 1026067675
Species Human (GRCh38) Human (GRCh38)
Location 7:67089355-67089377 7:67089400-67089422
Sequence CCCAAGGCTTAGGTATCCAGTGC GCTGGTAAAGGTCGAAGCGCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 8, 4: 81} {0: 2, 1: 1, 2: 2, 3: 3, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!