ID: 1026068123_1026068131

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1026068123 1026068131
Species Human (GRCh38) Human (GRCh38)
Location 7:67093468-67093490 7:67093518-67093540
Sequence CCTTCCACTTTCTGAGTTTTAGG CCTTTCTACTCAGCTGCTCATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 241} {0: 2, 1: 0, 2: 1, 3: 26, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!