ID: 1026088391_1026088400

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1026088391 1026088400
Species Human (GRCh38) Human (GRCh38)
Location 7:67280884-67280906 7:67280931-67280953
Sequence CCAGCCTGGCCAACATGGTGAAA AATGAGCTGGGCGTTCTGGTGGG
Strand - +
Off-target summary {0: 87987, 1: 159650, 2: 173325, 3: 160643, 4: 141633} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!