ID: 1026088393_1026088397

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1026088393 1026088397
Species Human (GRCh38) Human (GRCh38)
Location 7:67280893-67280915 7:67280919-67280941
Sequence CCAACATGGTGAAACCCTGTCTC TAGAAGCACAAAAATGAGCTGGG
Strand - +
Off-target summary {0: 31762, 1: 84237, 2: 130975, 3: 115475, 4: 69762} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!