ID: 1026111303_1026111310

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1026111303 1026111310
Species Human (GRCh38) Human (GRCh38)
Location 7:67460816-67460838 7:67460841-67460863
Sequence CCTGCCTGAAACTGACCAGTTGT CCTTAGGCAGGTAACATTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 113} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!