ID: 1026111923_1026111926

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1026111923 1026111926
Species Human (GRCh38) Human (GRCh38)
Location 7:67465292-67465314 7:67465314-67465336
Sequence CCATGGTCTTCTGCAGTAGCCAC CAGCAGCAACAGCTGGAGCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 122, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!