ID: 1026126561_1026126565

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1026126561 1026126565
Species Human (GRCh38) Human (GRCh38)
Location 7:67584740-67584762 7:67584762-67584784
Sequence CCTCACTGCTACATTCCCACCAG GCACCATGACAGTTTACAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 3, 3: 18, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!