ID: 1026204063_1026204070

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1026204063 1026204070
Species Human (GRCh38) Human (GRCh38)
Location 7:68240152-68240174 7:68240189-68240211
Sequence CCTGTCTTGTATCTAAGCCCTGG GCCTCCTCTAGAGTGGGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 364} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!