ID: 1026206297_1026206305

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1026206297 1026206305
Species Human (GRCh38) Human (GRCh38)
Location 7:68260709-68260731 7:68260758-68260780
Sequence CCATCCTCCTTCTTCTTTCCCTT GACCTCCTTGGATCTTTTACTGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 65, 3: 781, 4: 4155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!