ID: 1026285661_1026285662

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1026285661 1026285662
Species Human (GRCh38) Human (GRCh38)
Location 7:68960621-68960643 7:68960636-68960658
Sequence CCTGTTATTCACAGAAATTCCAT AATTCCATTCCATAAAGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!