ID: 1026346354_1026346358

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1026346354 1026346358
Species Human (GRCh38) Human (GRCh38)
Location 7:69477599-69477621 7:69477616-69477638
Sequence CCCAGCTACTCTGGAGGCTGAGT CTGAGTCAGGACTTGAATCTGGG
Strand - +
Off-target summary {0: 98, 1: 11724, 2: 228302, 3: 283005, 4: 170887} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!