ID: 1026352119_1026352124

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1026352119 1026352124
Species Human (GRCh38) Human (GRCh38)
Location 7:69526492-69526514 7:69526513-69526535
Sequence CCTGTGTTCTTGGCTGCACCCAC ACCCAGGATGGAGCTGTTACAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 8, 3: 35, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!