ID: 1026362450_1026362455

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1026362450 1026362455
Species Human (GRCh38) Human (GRCh38)
Location 7:69615161-69615183 7:69615204-69615226
Sequence CCCTCTGGTGGTCTATAATACCC AAAGAAACATAGTGTGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 70} {0: 1, 1: 0, 2: 2, 3: 39, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!