ID: 1026366040_1026366044

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1026366040 1026366044
Species Human (GRCh38) Human (GRCh38)
Location 7:69649459-69649481 7:69649504-69649526
Sequence CCGTGGTCCAGTTGTGCCTCCTT TCACTGTATGCTTTTTTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!