ID: 1026378796_1026378802

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1026378796 1026378802
Species Human (GRCh38) Human (GRCh38)
Location 7:69778491-69778513 7:69778525-69778547
Sequence CCCAGATAGTTGTAATGTGCAGT CTTACTGCTCTAACGTGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 286} {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!