ID: 1026385390_1026385392

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1026385390 1026385392
Species Human (GRCh38) Human (GRCh38)
Location 7:69842323-69842345 7:69842353-69842375
Sequence CCAGATAAACTTGTCCTAATTAT CTCTTTAAAGCACATACCTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!