ID: 1026416299_1026416306

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1026416299 1026416306
Species Human (GRCh38) Human (GRCh38)
Location 7:70184285-70184307 7:70184324-70184346
Sequence CCACAGAGAAGAGCAAATGCCAT CTATGCTGGGTAAAGTTTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!