ID: 1026421534_1026421542

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1026421534 1026421542
Species Human (GRCh38) Human (GRCh38)
Location 7:70242171-70242193 7:70242220-70242242
Sequence CCACCTCAGGTGGTTGCCCGTGC ACTGTGTAGAGGAGATTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65} {0: 1, 1: 0, 2: 2, 3: 30, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!