ID: 1026426320_1026426328

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1026426320 1026426328
Species Human (GRCh38) Human (GRCh38)
Location 7:70297957-70297979 7:70298007-70298029
Sequence CCTTTGCTCAGCTTTCTTAGAGC CTCTTTTTTTGGTTTTTTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 222, 3: 3329, 4: 23622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!