ID: 1026449264_1026449268

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1026449264 1026449268
Species Human (GRCh38) Human (GRCh38)
Location 7:70513015-70513037 7:70513060-70513082
Sequence CCTACTCAGCTTTAAGCACTCAA TTTAACAGATCTGCGTAATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!