ID: 1026451077_1026451078

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1026451077 1026451078
Species Human (GRCh38) Human (GRCh38)
Location 7:70530173-70530195 7:70530199-70530221
Sequence CCAAGGGGAGTTTTGCGTTGTGC GTGCAAATGCATATCCGTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!